HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"count": 127182,
"next": "https://api-test.medunigraz.at/v1/research/search/publication/?format=api&limit=20&offset=125520",
"previous": "https://api-test.medunigraz.at/v1/research/search/publication/?format=api&limit=20&offset=125480",
"results": [
{
"text": "\n522\nComparative investigations of airborne culturable microorganisms in selected waste treatment facilities and in neighbouring residential areas.\n\nReinthaler, FF\n\nHaas, D\n\nFeierl, G\n\nSchlacher, R\n\nPichler-Semmelrock, FP\n\nKöck, M\n\nWüst, G\n\nFeenstra, O\n\nMarth, E\n\nBeiträge in Fachzeitschriften\nISI:000081280100001\n10418096.0\nNone\nNone\nThe evaluation of airborne microorganisms in waste treatment facilities is complicated by different measuring systems, a lack of measuring standards and large variations between individual counts. In the present study, different sectors of the waste management industry were compared by determining median values of airborne culturable microorganisms from numerous parallel counts over a prolonged time period. The samples were taken during the warm season using the six-stage Andersen volumetric sampler in a large composting plant and its immediate vicinity, in an agricultural composting plant, a waste disposal site, and a sorting facility for recyclable materials. Control samples were taken at a site not influenced by the waste management industry in an open and largely uninhabited area. The highest median values for culturable bacteria (37 degrees C) found were 1.1 x 10(5) CFU/m3, for moulds (25 degrees C) 1.4 x 10(5) CFU/m3, and for A. fumigatus (37 degrees C) 1.7 x 10(4) CFU/m3 in the sorting cabins of the sorting facility (p < 0.001). The highest median values for thermophilic bacteria (actinomycetes and bacillaceae, 50 degrees C) were 7.3 x 10(3) CFU/m3 in the large composting facility. In all other facilities as well as in the neighbouring residential areas of all facilities investigated, all median values were significantly lower and corresponded to the naturally occurring levels: approx. 10(2) CFU/m3 for bacteria, approx. 10(3) CFU/m3 for moulds and approx. 10(1) CFU/m3 for A. fumigatus and thermophilic bacteria. Only in the neighbouring residential area of the large composting plant, the median values for thermophilic bacteria were approx. 10(2) CFU/m3, but an additional impact from farms cannot be excluded in this case. These results show permanent increased loads of the investigated microorganisms inside large composting facilities and especially in the sorting cabins for recyclable materials. The increasing number of reports on potential health hazards in these areas require adequate measures on the part of occupational medicine in order to limit the health risk to a minimum. The most important task is the automatization of the sorting process for recyclable materials.\n\nFeierl, Gebhard\n\nHaas, Doris\n\nMarth, Egon\n\nReinthaler, Franz\n\n\n"
},
{
"text": "\n34238\nPreventing neural tube defects in Europe: a missed opportunity.\n\nBusby, A\n\nAbramsky, L\n\nDolk, H\n\nArmstrong, B\n\nAddor, MC\n\nAnneren, G\n\nArmstrong, N\n\nBaguette, A\n\nBarisic, I\n\nBerghold, A\n\nBianca, S\n\nBraz, P\n\nCalzolari, E\n\nChristiansen, M\n\nCocchi, G\n\nDaltveit, AK\n\nDe Walle, H\n\nEdwards, G\n\nGatt, M\n\nGener, B\n\nGillerot, Y\n\nGjergja, R\n\nGoujard, J\n\nHaeusler, M\n\nLatos-Bielenska, A\n\nMcDonnell, R\n\nNeville, A\n\nOlars, B\n\nPortillo, I\n\nRitvanen, A\n\nRobert-Gnansia, E\n\nRösch, C\n\nScarano, G\n\nSteinbicker, V\n\nBeiträge in Fachzeitschriften\nISI:000230805200011\n15927445.0\n10.1016/j.reprotox.2005.03.009\nNone\nEach year, more than 4500 pregnancies in the European Union are affected by neural tube defects (NTD). Unambiguous evidence of the effectiveness of periconceptional folic acid in preventing the majority of neural tube defects has been available since 1991. We report on trends in the total prevalence of neural tube defects up to 2002, in the context of a survey in 18 European countries of periconceptional folic acid supplementation (PFAS) policies and their implementation. EUROCAT is a network of population-based registries in Europe collaborating in the epidemiological surveillance of congenital anomalies. Representatives from 18 participating countries provided information about policy, health education campaigns and surveys of PFAS uptake. The yearly total prevalence of neural tube defects including livebirths, stillbirths and terminations of pregnancy was calculated from 1980 to 2002 for 34 registries, with UK and Ireland estimated separately from the rest of Europe. A meta-analysis of changes in NTD total prevalence between 1989-1991 and 2000-2002 according to PFAS policy was undertaken for 24 registries. By 2005, 13 countries had a government recommendation that women planning a pregnancy should take 0.4mg folic acid supplement daily, accompanied in 7 countries by government-led health education initiatives. In the UK and Ireland, countries with PFAS policy, there was a 30% decline in NTD total prevalence (95% CI 16-42%) but it was difficult to distinguish this from the pre-existing strong decline. In other European countries with PFAS policy, there was virtually no decline in NTD total prevalence whether a policy was in place by 1999 (2%, 95% CI 28% reduction to 32% increase) or not (8%, 95% CI 26% reduction to 16% increase). The potential for preventing NTDs by periconceptional folic acid supplementation is still far from being fulfilled in Europe. Only a public health policy including folic acid fortification of staple foods is likely to result in large-scale prevention of NTDs.\n\nBerghold, Andrea\n\n\n"
},
{
"text": "\n81979\nIndividual patient meta-analysis of self-monitoring of an oral anticoagulation protocol.\n\nPerera, R\n\nHeneghan, C\n\nFitzmaurice, D\n\nSelf Monitoring Trialists (SMT) collaboration\n\nBeiträge in Fachzeitschriften\nISI:000254636200018\n18512497.0\nNone\nNone\nBackground and aim of the study: Oral anticoagulation with vitamin K antagonists is effective for the prevention and treatment of thromboembolic events. Recent systematic reviews have shown that self-monitoring improved the quality of oral anticoagulation therapy (OAT), with patients spending more time in the therapeutic range than traditionally monitored patients, and with a concomitant decrease in the incidence of adverse effects. However, methodological and reporting heterogeneity has limited the strength of the reviews' conclusions. Differences were noted in terms of the assessment of outcome measures and the analysis methods used. For instance, not all used an intention-to-treat analysis, which may have over-inflated the results. Interpretation was limited by missing data: for example, it was not possible to combine mean tests in range, mean time in range, or to determine the level of deviant values. Time-to-event data (e.g., death, thromboembolic events) were reported as numbers of events, which prevented adequate analysis. In order to overcome these limitations and allow further investigation of the data, the study aim is to undertake an Individual Patient Data (IPD) meta-analysis. Methods and study design: The IPD analysis will include data from randomized trials that have compared self-monitoring (self-testing or self-management) OAT versus a control group, and that measured adverse events defined as major hemorrhage, thromboembolism, and death. The data to be requested for each trial will include: outcomes, demographic and psychosocial (e.g., quality of life) data. The primary outcomes of interest will be time to major hemorrhage, thromboembolism, and death. The secondary outcomes will be minor hemorrhage, percentage time within range, percentage tests within range, and patient satisfaction. The primary analysis will be by intention to treat, and multilevel models with patients and trials as the two levels, will be explored to investigate treatment effects on various outcomes. Patient-level covariates will be incorporated into the models in an attempt to account for statistical heterogeneity, as well as to investigate interactions with treatment effect. Conclusion: Predictive models should lead to the identification of those most likely to benefit from self-monitoring of oral anticoagulation, and potentially also to a targeted and a more cost-effective use of the intervention.\n\nSiebenhofer-Kroitzsch, Andrea\n\n\n"
},
{
"text": "\n108073\nGeographic differences in the target-controlled infusion estimated concentration of propofol: bispectral index response curves.\n\nDahaba, AA\n\nZhong, T\n\nLu, HS\n\nBornemann, H\n\nLiebmann, M\n\nWilfinger, G\n\nReibnegger, G\n\nMetzler, H\n\nBeiträge in Fachzeitschriften\nISI:000288663100003\n21264558.0\n10.1007/s12630-011-9453-2\nNone\nVariability in drug responses could result from both genetic and environmental factors. Thus, drug effect could depend on geographic location, although regional variation is not generally acknowledged as a basis for stratification. There is evidence that the pharmacokinetic set developed in a European population for the target-controlled infusion (TCI) of propofol does not apply in Chinese patients; however, we are not aware of previous studies comparing the estimated concentration-bispectral index (BIS) response of Caucasian patients in Europe with that of Chinese patients in China. The Diprifusor(TM) TCI pump, incorporating the pharmacokinetic model proposed by Marsh et al., was applied to 30 Caucasian patients in Austria and 30 Chinese patients in China. The estimated plasma concentration (C(p)) of propofol for the two groups was set at 1 mu g center dot mL(-1) and increased by 1 mu g center dot mL(-1) every minute to gradually reach 5 mu g center dot mL(-1) after 5 min. The BIS values were fitted against the estimated C(p) and the predicted effect-site concentration (C(e)) in a sigmoid E(max) model. The sigmoid E(max) curves were shifted significantly to the left in the Chinese group compared with the Austrian group. After 5 min, the BIS value in the Chinese group was lower than in the Austrian group (mean +/- A standard deviation [SD], 47.2 +/- A 3.6 vs 63.6 +/- A 5.4, respectively; P = 0.0006). The estimated C(p) at loss of consciousness (LOC), predicted C(e) at LOC, and time to LOC, were lower in the Chinese group than in the Austrian group (3.3 +/- A 0.8 mu g center dot mL(-1), 1.6 +/- A 0.4 mu g center dot mL(-1), 2.8 +/- A 0.6 min, respectively, vs 4.6 +/- A 2.8 mu g center dot mL(-1), 2.4 +/- A 1.5 mu g center dot mL(-1), 3.9 +/- A 0.5 min, respectively; P < 0.0001). When propofol is given using the same TCI protocol, Chinese patients in China lost consciousness faster and at a lower estimated plasma concentration than Caucasians in Austria. Larger studies are needed to map geographically appropriate TCI infusion models.\n\nBornemann-Cimenti, Helmar\n\nMetzler, Helfried\n\nReibnegger, Gilbert\n\n\n"
},
{
"text": "\n142460\nDetection of the WT1 transcript by RT-PCR in complete remission has no prognostic relevance in de novo acute myeloid leukemia.\n\nGaiger, A\n\nSchmid, D\n\nHeinze, G\n\nLinnerth, B\n\nGreinix, H\n\nKalhs, P\n\nTisljar, K\n\nPriglinger, S\n\nLaczika, K\n\nMitterbauer, M\n\nNovak, M\n\nMitterbauer, G\n\nMannhalter, C\n\nHaas, OA\n\nLechner, K\n\nJäger, U\n\nBeiträge in Fachzeitschriften\nISI:000077563400006\n9844919.0\n10.1038/sj.leu.2401213\nNone\nThe WT1 gene is expressed in 73-100% of patients with acute myelogenous leukemia (AML) and is thought to play a role in maintaining the viability of leukemic cells. WT1 has been proposed as a marker for minimal residual disease in leukemia. We obtained serial blood or bone marrow samples from patients with de novo AML at diagnosis, during therapy, and up to 95 months after diagnosis and analyzed for WT1 gene expression by RT-PCR to determine whether gene expression was predictive of relapse. Forty-four patients had WT1-positive AML and achieved a complete remission (CR) following chemotherapy and 24 patients underwent unrelated donor (n = 4), sibling donor (n = 13) or autologous (n = 7) marrow transplantation. After achieving CR 62% of the patients became WT1-negative, while 38% remained WT1-positive. There was no difference in the disease-free survival (DFS) and survival from remission between WT1-positive and -negative patients (P > 0.1). Following BMT, 32% of the patients analyzed in CR within the first 100 days after transplantation were WT1 PCR positive. Detection of WT1 transcripts within 100 days following BMT did not affect DFS and overall survival (OS) after transplantation (P > 0.1). Ten of 11 patients who are in continuous CR following chemotherapy or BMT for more than 3 years were transiently WT1-positive during the observation period. Four of these patients displayed the WT1 transcript at the last examination. Thirteen of 39 patients were WT1 PCR negative within 4 months before clinical onset of relapse and eight patients were WT1 PCR negative at time of relapse. These data indicate that: (1) achievement of WT1 negativity is not associated with longer DFS, survival from remission, or OS after transplantation; (2) not all patients who relapse become WT1 positive again; (3) long-term remitters frequently display the WT1 transcript. Thus, we conclude that the monitoring of WT1 gene expression by qualitative RT-PCR during treatment and CR is of very limited value.\n\nGreinix, Hildegard\n\n\n"
},
{
"text": "\n169856\nAtlas of the Immune Cell Repertoire in Mouse Atherosclerosis Defined by Single-Cell RNA-Sequencing and Mass Cytometry.\n\nWinkels, H\n\nEhinger, E\n\nVassallo, M\n\nBuscher, K\n\nDinh, HQ\n\nKobiyama, K\n\nHamers, AAJ\n\nCochain, C\n\nVafadarnejad, E\n\nSaliba, AE\n\nZernecke, A\n\nPramod, AB\n\nGhosh, AK\n\nAnto Michel, N\n\nHoppe, N\n\nHilgendorf, I\n\nZirlik, A\n\nHedrick, CC\n\nLey, K\n\nWolf, D\n\nBeiträge in Fachzeitschriften\nISI:000434652500010\n29545366.0\n10.1161/CIRCRESAHA.117.312513\nPMC5993603\nAtherosclerosis is a chronic inflammatory disease that is driven by the interplay of pro- and anti-inflammatory leukocytes in the aorta. Yet, the phenotypic and transcriptional diversity of aortic leukocytes is poorly understood.\n We characterized leukocytes from healthy and atherosclerotic mouse aortas in-depth by single-cell RNA-sequencing and mass cytometry (cytometry by time of flight) to define an atlas of the immune cell landscape in atherosclerosis.\n Using single-cell RNA-sequencing of aortic leukocytes from chow diet- and Western diet-fed Apoe-/- and Ldlr-/- mice, we detected 11 principal leukocyte clusters with distinct phenotypic and spatial characteristics while the cellular repertoire in healthy aortas was less diverse. Gene set enrichment analysis on the single-cell level established that multiple pathways, such as for lipid metabolism, proliferation, and cytokine secretion, were confined to particular leukocyte clusters. Leukocyte populations were differentially regulated in atherosclerotic Apoe-/- and Ldlr-/- mice. We confirmed the phenotypic diversity of these clusters with a novel mass cytometry 35-marker panel with metal-labeled antibodies and conventional flow cytometry. Cell populations retrieved by these protein-based approaches were highly correlated to transcriptionally defined clusters. In an integrated screening strategy of single-cell RNA-sequencing, mass cytometry, and fluorescence-activated cell sorting, we detected 3 principal B-cell subsets with alterations in surface markers, functional pathways, and in vitro cytokine secretion. Leukocyte cluster gene signatures revealed leukocyte frequencies in 126 human plaques by a genetic deconvolution strategy. This approach revealed that human carotid plaques and microdissected mouse plaques were mostly populated by macrophages, T-cells, and monocytes. In addition, the frequency of genetically defined leukocyte populations in carotid plaques predicted cardiovascular events in patients.\n The definition of leukocyte diversity by high-dimensional analyses enables a fine-grained analysis of aortic leukocyte subsets, reveals new immunologic mechanisms and cell-type-specific pathways, and establishes a functional relevance for lesional leukocytes in human atherosclerosis.\n © 2018 American Heart Association, Inc.\n\nAnto Michel, Nathaly\n\nZirlik, Andreas\n\n\n"
},
{
"text": "\n173875\nGuideline Myotonic Dystrophies, Non-Dystrophic Myotonias and Periodic Paralyses\n\nSchneider-Gold, C\n\nSchoser, B\n\nEllrichmann, G\n\nQuasthoff, S\n\nLehmann-Horn, F\n\nSinnreich, M\n\nBeiträge in Fachzeitschriften\nISI:000429996200002\nNone\n10.1055/s-0043-125352\nNone\nIn the last years several new therapeutic options and strategies in the treatment of myotonias, myotonic dystrophies and periodic paralyses have been published. All relevant novel aspects in the treatment of muscle ion channel diseases are summarized in the respective guideline of the German Society of Neurology which has been updated very recently. The most important points are: Mexiletine is no more available in Germany, but it is still possible to get retarded 100mg or 200 preparations from Japan, the U.S.or Canada. The positive effects of mexiletine in the treatment of myotonic symptoms even in myotonic dystrophy type I have convincingly been shown in a double-blind placebo controlled study (Logigian et al., 2010). In a very recent study dichlorphenamide, a carboanhydrase inhibitor, was shown to be effective in hypo- and hyperkalemic periodic paralyses leading to significant reduction of the frequency of attacks (Sansone et al., 2016). In this study two randomized placebo-controlled studies over a time period of 9 weeks followed by a one year extension phase with application of dichlorphenamide in all patients were combined. The comparative actazolamide arm of the study had to be closed because most patients preferred dichlorphenamide for less subjective side effects. The main side effects reported under dichlorphenamide were paraesthesias, reduced velocity of thinking, and development of renal stones. The study did not allow for retrieving conclusions regarding the relation of efficacy and genotype. The most frequent mutations were T704M (Nav1.4) in hyperkalemic periodic paralysis and R528H (Cav1.1) and R1239H (Cav1.1) in hypokalemic paralysis. One patient with hypokalemic periodic paralysis and a pR222W (Nav1.4) mutation showed deterioration of his symptoms while taking dichlorphenamide. Dichlorphenamide is now available in the US, in Europe it has not been finally approved so far; but the classification as "orphan drug allows for prescription. Another recent double-blind placebo controlled study showed significant improvement of myotonic symptoms as compared to baseline in 22 patients with nondystrophic myotonia treated with either lamotrigine 300mg daily (Anderson G et al., 2017). In a recently published open observational study ranolazine, 2x500mg was shown to significantly reduce clinical and EMG myotonia and to improve muscle weakness in 13 patients with chloride channel (Arnold WD et al., 2017).\n\nQuasthoff, Stefan\n\n\n"
},
{
"text": "\n180124\nSynergistic and antagonistic interactions between antibiotics and synbiotics in modifying the murine fecal microbiome.\n\nJačan, A\n\nKashofer, K\n\nZenz, G\n\nFröhlich, EE\n\nReichmann, F\n\nHassan, AM\n\nHolzer, P\n\nBeiträge in Fachzeitschriften\nISI:000546963100006\n31263983.0\n10.1007/s00394-019-02035-z\nPMC7351849\nPro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure.\n The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts.\n Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery.\n There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.\n\nHASSAN, Ahmed\n\nHolzer, Peter\n\nKashofer, Karl\n\nReichmann, Florian\n\n\n"
},
{
"text": "\n182334\nLevosimendan in patients with reduced left ventricular function undergoing isolated coronary or valve surgery.\n\nvan Diepen, S\n\nMehta, RH\n\nLeimberger, JD\n\nGoodman, SG\n\nFremes, S\n\nJankowich, R\n\nHeringlake, M\n\nAnstrom, KJ\n\nLevy, JH\n\nLuber, J\n\nNagpal, AD\n\nDuncan, AE\n\nArgenziano, M\n\nToller, W\n\nTeoh, K\n\nKnight, JD\n\nLopes, RD\n\nCowper, PA\n\nMark, DB\n\nAlexander, JH\n\nBeiträge in Fachzeitschriften\nISI:000533535300045\n31358329.0\n10.1016/j.jtcvs.2019.06.020\nNone\nIn the Levosimendan in Patients with Left Ventricular Systolic Dysfunction Undergoing Cardiac Surgery Requiring Cardiopulmonary Bypass (LEVO-CTS) trial, no differences in clinical outcomes were observed between levosimendan and placebo in a broad population of patients undergoing cardiac surgery. In previous studies, the benefits of levosimendan were most clearly evident in patients undergoing isolated coronary artery bypass grafting (CABG) surgery. In a prespecified analysis of LEVO-CTS, we compared treatment-related outcomes and costs across types of cardiac surgical procedures.\n Overall, 563 (66.4%) patients underwent isolated CABG, 97 (11.4%) isolated valve, and 188 (22.2%) combined CABG/valve surgery. Outcomes included the co-primary 4-component composite (30-day mortality, 30-day renal replacement, 5-day myocardial infarction, or 5-day mechanical circulatory support), the 2-component composite (30-day mortality or 5-day mechanical circulatory support), 90-day mortality, low cardiac output syndrome (LCOS), and 30-day medical costs.\n The 4- and 2-component outcomes were not significantly different with levosimendan and placebo in patients undergoing CABG (15.2% vs 19.3% and 7.8% vs 10.4%), valve (49.0% vs 33.3% and 22.4% vs 2.1%), or combined procedures (39.6% vs 35.9% and 24.0% vs 19.6%). Ninety-day mortality was lower with levosimendan in isolated CABG (2.1% vs 7.9%; hazard ratio [HR], 0.26; 95% confidence interval [CI], 0.11-0.64), but not significantly different in valve (8.3% vs 2.0%; HR, 4.10; 95% CI, 0.46-36.72) or combined procedures (10.4% vs 7.6%; HR, 1.39; 95% CI, 0.53-3.64; interaction P = .011). LCOS (12.0% vs 22.1%; odds ratio, 0.48; 95% CI, 0.30-0.76; interaction P = .118) was significantly lower in levosimendan-treated patients undergoing isolated CABG. Excluding study drug costs, median and mean 30-day costs were $53, 07 and $65, 52 for levosimendan and $54, 36 and $67, 22 for placebo, with a 30-day mean difference (levosimendan - placebo) of -$1270 (bootstrap 95% CI, -$8722 to $6165).\n Levosimendan was associated with lower 90-day mortality and LCOS in patients undergoing isolated CABG, but not in those undergoing isolated valve or combined CABG/valve procedures.\n Copyright © 2019 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.\n\nToller, Wolfgang\n\n\n"
},
{
"text": "\n4577\nMeasurement of IgE antibodies using liquid allergens--an inter-method and inter-laboratory quality assessment.\n\nAberer, W\n\nKränke, B\n\nBeiträge in Fachzeitschriften\nISI:000179741600010\n12528326.0\nNone\nNone\nBACKGROUND: The determination of IgE antibodies is important for the in vitro diagnosis of allergic diseases. However, not all systems currently available in the market fulfill essential quality criteria, e.g. regarding characteristics such as sensitivity and specificity, and the data do not always reflect true clinical relevance in the required fashion. Recent innovations may reduce the workload for the technician, and thus help save time and money. More importantly, they might reduce potential sources of error. OBJECTIVE: Two allergy systems, the well established Pharmacia CAP system that uses the allergens conventionally in a solid phase and the ALLERgen system that employs liquid allergens, were compared with regard to quality criteria and practicability. METHODS: Defined serum pools were checked for within-run and between-days imprecision of IgE antibody detection in two independent laboratories. Serum specimens from allergic patients and controls were tested in parallel using both methods for total and antigen-specific IgE antibody detection under standardized conditions. In addition, one laboratory working exclusively with the ALLERgen system participated in the Austrian inter-laboratory quality assessment program. RESULTS: The two systems were comparable in terms of sensitivity and specificity, and also showed good correlation. Within-run evaluations were excellent for total IgE and antigen-specific IgE, and the between-days imprecision was satisfactory. Coefficients of variation were within an acceptable range for the different groups of allergens. In the external quality control program the data obtained with the ALLERgen system showed good concordance with other systems in use; up to 94% of the results were identical when considering clinically relevant sensitizations. Regarding practicability, both systems were most satisfactory for the operator. The ALLERgen system offered a certain advantage in terms of automated operation, which resulted in shorter fixed and variable phases of personnel time. CONCLUSION: Both the Pharmacia CAP system and the ALLERgen system belong to an advanced generation of allergy test systems and are easy to handle. The reproducibility of results is good with both methods, and the imprecision data fall within an acceptable range. Thus, the ALLERgen system is a reliable in vitro system for evaluating specific and total IgE in serum, providing data equivalent to those obtained with the CAP system.\n\nAberer, Werner\n\nKränke, Birger\n\n\n"
},
{
"text": "\n52630\nEffect of nitric oxide on the development of nitrofen-induced fetal hypoplastic lung explants.\n\nShinkai, M\n\nShinkai, T\n\nPirker, ME\n\nMontedonico, S\n\nPuri, P\n\nBeiträge in Fachzeitschriften\nISI:000226927000003\n15861370.0\n10.1016/j.jpedsurg.2004.09.007\nNone\nBackground/Purpose: Nitric oxide (NO) is an important cell-signaling molecule, and its generators, nitric oxide synthases, are expressed temporospatially in fetal rat lung. Recently, NO has been reported to modulate branching of the fetal rat lung lobe in vitro. We designed this study to evaluate the effect of NO on the morphogenesis of hypoplastic lung using nitrofen-induced rat lung explant model. Methods: A hypoplastic fetal lung model and a normal control lung model were induced by feeding a pregnant rat with nitrofen (100 mg) or olive oil on day 9.5 of gestation, respectively. Fetal lungs were harvested on day 13.5 and placed in organ culture containing serum-free medium Dulbecco modified Eagle medium. An NO donor, DETA NONOate (DETA/NO), was added daily in the culture medium. The lung cultures were divided into 4 groups: group 1 (n = 8), normal controls without DETA/NO; group 2 (n = 22), normal controls with DETA/NO; group 3 (n = 13), hypoplastic lungs without DETA/NO; group 4 (n = 22), hypoplastic lungs with DETA/NO. The fetal lungs were incubated for 48 hours at 37degreesC with 5% CO2. Lung bud count and area of the specimens were measured under computer-assisted digital tracings. The rate of increase in bud count and lung area was calculated as the ratio of each value at 48 hours minus each value at 0 hour, divided by the value at 0 hour. Results: The lung bud count was significantly increased in group 2 compared with group 1 at a concentration of 50 mumol/L DETA/NO (P < .05). In the nitrofen group, the lung bud count was significantly increased in group 4 compared with group 3 at 100 mumol/L DETA/NO added (P < .05). There was no significant difference in the rate of increase in whole lung area among the 4 groups. The peak increase rates of lung area and bud count were significantly lower in group 4 compared with group 2. Conclusions: This study demonstrates that the NO donor, DETA/NO, promotes branching of the nitrofen-induced hypoplastic fetal lung explant. These data suggest that NO may modulate the development of the nitrofen-induced hypoplastic lung. (C) 2005 Elsevier Inc. All rights reserved.\n\n\n"
},
{
"text": "\n53244\nThe NK1 receptor antagonist SR140333 inhibits capsaicin-induced ERK phosphorylation in sensory neurons.\n\nDonnerer, J\n\nLiebmann, I\n\nBeiträge in Fachzeitschriften\nISI:000239244100006\n16788306.0\n10.1159/000094022\nNone\nPrimary sensory neurons respond to a vigorous excitation via the capsaicin receptor/TRPV1 cation channel by a phosphorylation of the Jak/STAT pathway as measured by phospho-STAT3, and of the Ras/Raf-MAPK pathway as measured by phospho-MAPK/ERK1/2. In the present investigation a possible involvement of NK1 receptors in the capsaicin-induced activation of these signal transduction pathways was investigated by protein extraction and Western immunoblotting. Phospho-MAPK/ERK1/2 and phospho-STAT3 were determined in the dorsal root ganglia (DRG) and in the sciatic nerve of rats at 3 and 6 h following a systemic capsaicin treatment without or with the pretreatment of the selective NK1 receptor antagonist SR140333 (1 mg/kg s.c.; 3 h before capsaicin). Capsaicin evoked a threefold increase in phospho-ERK in the sciatic nerve and a two- to threefold increase in the DRG at 3 h and 6 h after the treatment. SR140333 markedly attenuated the capsaicin-induced increase in phosphorylated ERK. In the sciatic nerve the difference was significant at each individual time point (3 and 6 h, p < 0.001). In the DRG the difference was significant when the data at 3 h and 6 h were combined (p < 0.05), but not when individual time points were considered. Capsaicin evoked a four- to fivefold increase in phospho-STAT3 in the sciatic nerve and a twofold increase in the DRG at 3 and 6 h after the treatment. SR140333 less markedly attenuated the capsaicin-induced increase in phosphorylated STAT3: whereas in the sciatic nerve the difference was significant when the data at 3 h and 6 h were combined (p < 0.05), no such treatment effect of SR140333 was observed in the DRG. The expression of TRPV1 mRNA, a specific marker of capsaicin-sensitive small sensory neurons, was investigated by RT-PCR 4 days after the capsaicin treatment. Treatment of rats with SR140333 had no influence on the long-term downregulation of TRPV1 mRNA by capsaicin. Based on the present results and previous findings it can be postulated that the capsaicin-induced ERK phosphorylation in sensory neurons is not a direct effect by capsaicin, but that rather substance P release from the stimulated sensory neurons with an NK1-mediated nerve growth factor (NGF) production is involved.\n\nDonnerer, Josef\n\n\n"
},
{
"text": "\n64067\nEfficiency of fleece-bound sealing (TachoSil) of air leaks in lung surgery: a prospective randomised trial.\n\nAnegg, U\n\nLindenmann, J\n\nMatzi, V\n\nSmolle, J\n\nMaier, A\n\nSmolle-Jüttner, F\n\nBeiträge in Fachzeitschriften\nISI:000244320900013\n17187983.0\n10.1016/j.ejcts.2006.11.033\nNone\nOBJECTIVE: Persistent air leakage following pulmonary resection is a major limiting factor for discharge from hospital. The aim of this study was to evaluate the sealing capacity of TachoSil for the closure of alveolar air leaks following parenchymal resections and to determine its effect on time to chest drain removal and duration of hospitalisation. Methods: A total of 173 patients undergoing lobectomy or segmentectomy were enrolled in a single-centre, randomised study to compare the efficacy of TachoSil with standard treatment. Alveolar air leaks were evaluated intraoperatively by submersion of the resection site in saline and were graded according to the Macchiarini scale as 0 (no bubbles), 1 (single bubbles), 2 (stream of bubbles), 3 (coalescent bubbles). Patients with grade 1 or 2 air leaks were randomised to TachoSil or standard treatment. Grade 3 patients received standard treatment until the air leak was downgraded to grade 1 or 2 at which point they were randomised. Patients with grade 0 leakage were excluded. The primary efficacy endpoints of the study were postoperative quantification of air leakage on postoperative days 1 and 2. Other efficacy measurements included mean time to chest drain removal and mean time to hospital discharge. Results: The mean intraoperative post-treatment air leakage was significantly lower in the TachoSil group (153.32ml/min, range: 10-450ml/min) compared with the standard treatment group (251.04ml/min, range: 15-970ml/min; P=0.009). The significant difference in air leakage volume observed intraoperatively post-treatment was maintained postoperatively. TachoSil showed a trend towards reduced incidence of postoperative leakage when measured >48h or >7 days after surgery (30.7% vs 38.96% and 24% vs 32.46%, respectively). The mean times to chest drain removal and to hospital discharge were significantly reduced following the use of TachoSil (5.1 days vs 6.3 days, P=0.022 and 6.2 days vs 7.7 days, P=0.01, respectively). Conclusions: The use of TachoSil following pulmonary resection resulted in a reduction in air leakage compared with standard techniques. This reduction in air leakage resulted in a significant reduction in both the time to chest drain removal and the period of hospitalisation.\n\nAnegg, Udo\n\nLindenmann, Jörg\n\nMaier, Alfred\n\nMatzi, Veronika\n\nSmolle, Josef\n\nSmolle-Juettner, Freyja-Maria\n\n\n"
},
{
"text": "\n138395\nResults of a comparative study analyzing octogenarians with renal cell carcinoma in a competing risk analysis with patients in the seventh decade of life.\n\nMay, M\n\nCindolo, L\n\nZigeuner, R\n\nDe Cobelli, O\n\nRocco, B\n\nDe Nunzio, C\n\nTubaro, A\n\nComan, I\n\nTruss, M\n\nDalpiaz, O\n\nWolff, I\n\nFeciche, B\n\nFenske, F\n\nPichler, M\n\nSchips, L\n\nFigenshau, RS\n\nMadison, K\n\nSánchez-Chapado, M\n\nSantiago Martin, Mdel C\n\nSalzano, L\n\nLotrecchiano, G\n\nWaidelich, R\n\nStief, C\n\nSountoulides, P\n\nBrookman-May, S\n\nMembers of CORONA project\n\nYoung Academic Urologists Renal Cancer Group\n\nBeiträge in Fachzeitschriften\nISI:000346627300023\n25129141.0\n10.1016/j.urolonc.2014.04.013\nNone\nTo analyze clinicopathological features and survival of surgically treated patients with renal cell carcinoma (RCC) ≥ 80 years of age in comparison with patients between the ages of 60 and 70 years.\n The data for 2, 16 patients with a median follow-up of 57 months were retrieved from a multinational database (Collaborative Research on Renal Neoplasms Association [CORONA]), including data for 6, 34 consecutive patients with RCC after radical or partial nephrectomy. Comparative analysis of clinicopathological features of 241 octogenarians (3.9% of the database) and 2, 75 reference patients between the ages of 60 and 70 years (36.5%) was performed. Multivariable regression analysis adjusted for competing risks was applied to identify the effect of advanced age on cancer-specific mortality (CSM) and other-cause mortality (OCM). Furthermore, instrumental variable analysis was employed to reduce residual confounding by unmeasured parameters.\n Significantly more women were present (50% vs. 40%, P = 0.004), and significantly less often nephron-sparing surgery was performed in octogenarians compared with the reference group (11% vs. 20%, P<0.001). Although median tumor size and stages did not significantly defer, older patients less often had advanced or metastatic disease (N+/M1) (4.6% vs. 9.6%, P = 0.009). On multivariable analysis, higher CSM (hazard ratio = 1.48, P = 0.042) and OCM rates (hazard ratio = 4.32, P<0.001) were detectable in octogenarians (c-indices = 0.85 and 0.72, respectively). Integration of the variable age group in multivariable models significantly increased the predictive accuracy regarding OCM (6%, P<0.001), but not for CSM. Limitations are based on the retrospective study design.\n Octogenarian patients with RCC significantly differ in clinical features and display significantly higher CSM and OCM rates in comparison with their younger counterparts.\n Copyright © 2014 Elsevier Inc. All rights reserved.\n\nDalpiaz, Orietta\n\nPichler, Martin\n\nZigeuner, Richard\n\n\n"
},
{
"text": "\n146073\nQuality of life after treatment of neuroendocrine liver metastasis.\n\nSpolverato, G\n\nBagante, F\n\nWagner, D\n\nBuettner, S\n\nGupta, R\n\nKim, Y\n\nMaqsood, H\n\nPawlik, TM\n\nBeiträge in Fachzeitschriften\nISI:000360707300025\n26095419.0\n10.1016/j.jss.2015.05.048\nNone\nA large subset of patients with neuroendocrine liver metastasis (NELM) is symptomatic at the time of presentation. In addition to improving survival, treatment of NELM seeks to provide palliation of symptoms. However, data on health-related quality of life (QoL) are uncommon. We sought to define patient-reported QoL after treatment of NELM.\n Patients who underwent treatment of NELM at Johns Hopkins Hospital between 1998 and 2013 and who were alive as of March 2014 were identified (n = 125). These patients were invited to complete a QoL survey designed using validated assessment tools, to assess their physical, mental, and general health before treatment, after the most recent treatment and at the time of the study. Clinicopathologic data were collected and correlated with QoL data.\n The response rate was 68.0% (n = 85). Median patient age was 55 y and most were male (59.2%). Most patients had a pancreatic (24.7%) or a small bowel (37.7%) primary tumor; the overwhelming majority had multiple NELM (83.5%). Patient-reported symptoms before any treatment included diarrhea (41.1%), flushing (34.1%), fatigue (36.5%), and osteoarticular pain (18.8%). Initial treatment of NELM consisted of surgery in 55 patients (64.7%) and nonsurgical treatment in 30 patients (35.3%). Many patients reported an overall improvement in physical health and mental health. Specifically, the proportion of patients reporting diarrhea (before any treatment, 41.1% versus currently, 25.9%; P = 0.019) and flushing (before any treatment, 34.1% versus currently, 10.5%; P < 0.001) tended to decrease over time and a lower proportion of patients reported to be currently sad about being ill (before any treatment, 31.8% versus currently, 23.2%; P = 0.009). Patients with a very poor QoL at the time of the diagnosis were more likely to experience an improvement in QoL after treatment. Interestingly, there was no difference in the improvement in overall QoL whether the initial treatment for NELM was surgical or nonsurgical; however, a lower proportion of patients were dissatisfied with surgery versus nonsurgical therapy (5.4% versus 9.4%; P = 0.001).\n Less than one-fourth of patients experienced a significant improvement in QoL after treatment of NELM. The patients who benefit the most of treatment were those who were more symptomatic before any treatment.\n Copyright © 2015 Elsevier Inc. All rights reserved.\n\nWagner, Doris\n\n\n"
},
{
"text": "\n160402\nStage IV Gastro-Entero-Pancreatic Neuroendocrine Neoplasms: A Risk Score to Predict Clinical Outcome.\n\nPanzuto, F\n\nMerola, E\n\nPavel, ME\n\nRinke, A\n\nKump, P\n\nPartelli, S\n\nRinzivillo, M\n\nRodriguez-Laval, V\n\nPape, UF\n\nLipp, R\n\nGress, T\n\nWiedenmann, B\n\nFalconi, M\n\nDelle Fave, G\n\nBeiträge in Fachzeitschriften\nISI:000399440600009\n28232598.0\n10.1634/theoncologist.2016-0351\nPMC5388376\nSeveral risk factors predict clinical outcome in gastro-entero-pancreatic neuroendocrine neoplasms (GEP-NENs); however, the impact of their combination has not been investigated so far.\n A retrospective analysis of stage IV GEP-NENs was performed. Multivariate analysis for progression of disease (PD) was performed by Cox proportional hazards method to obtain a risk score. Area under the curve obtained by receiver operating characteristic analysis was used to assess the score performance. Progression-free survival analysis was performed by Kaplan-Meier method.\n Two hundred eighty-three stage IV GEP-NENs were evaluated, including 93 grade 1 neuroendocrine tumors (32.9%), 153 grade 2 neuroendocrine tumors (54%), and 37 grade 3 neuroendocrine carcinomas (13.1%). Independent risk factors for PD were Ki67, proportion of metastatic liver involvement, and presence of extra-abdominal metastases. The risk score was calculated as follows: (0.025 × Ki67) + [(0 if no liver metastases or liver involvement <25%) OR (0.405 if liver involvement 25%-50%) OR (0.462 if liver involvement >50%)] + [(0 if no extra-abdominal metastases) OR (0.528 if extra-abdominal metastases present)]. The risk score accuracy to predict PD was superior compared with the G grading system (area under the curve: 0.705 and 0.622, respectively). Three subgroups of patients with low, intermediate, and high risk of PD according to risk score were identified, median progression-free survival being 26 months, 19 months, and 12 months, respectively.\n In stage IV GEP-NENs, a risk score able to predict PD was obtained by combining Ki67, proportion of metastatic liver involvement, and presence of extra-abdominal metastases. The score may help to discriminate patients with different progression risk level to plan tailored therapeutic approaches and follow-up programs. \nThe Oncologist\n 2017;22:409-415Implications for Practice: Clinical outcome of patients with advanced gastro-entero-pancreatic neuroendocrine neoplasms is affected by several risk factors, including the proliferative index Ki67, extension of liver metastases, and the presence of distant extra-abdominal lesions. A risk score that combines these variables may help physicians dealing with these diseases to plan the optimal therapeutic approach and follow-up program.\n © AlphaMed Press 2017.\n\nKump, Patrizia\n\nLipp, Rainer\n\n\n"
},
{
"text": "\n172700\nImpact of physical exercise on sensor performance of the FreeStyle Libre intermittently viewed continuous glucose monitoring system in people with Type 1 diabetes: a randomized crossover trial.\n\nMoser, O\n\nEckstein, ML\n\nMueller, A\n\nBirnbaumer, P\n\nAberer, F\n\nKoehler, G\n\nSourij, C\n\nKojzar, H\n\nHoller, P\n\nSimi, H\n\nPferschy, P\n\nDietz, P\n\nBracken, RM\n\nHofmann, P\n\nSourij, H\n\nBeiträge in Fachzeitschriften\nISI:000465088500010\n30677187.0\n10.1111/dme.13909\nNone\nTo evaluate the sensor performance of the FreeStyle Libre intermittently viewed continuous glucose monitoring system using reference blood glucose levels during moderate-intensity exercise while on either full or reduced basal insulin dose in people with Type 1 diabetes.\n Ten participants with Type 1 diabetes [four women, mean ± sd age 31.4 ± 9.0 years, BMI 25.5±3.8 kg/m2 , HbA1c 55±7 mmol/mol (7.2±0.6%)] exercised on a cycle ergometer for 55 min at a moderate intensity for 5 consecutive days at the clinical research facility, while receiving either their usual or a 75% basal insulin dose. After a 4-week washout period, participants performed the second exercise period having switched to the alternative basal insulin dose. During exercise, reference capillary blood glucose values were analysed using the fully enzymatic-amperometric method and compared with the interstitial glucose values obtained. Intermittently viewed continuous glucose monitoring accuracy was analysed according to median (interquartile range) absolute relative difference, and Clarke error grid and Bland-Altman analysis for overall glucose levels during exercise, stratified by glycaemic range and basal insulin dosing scheme (P<0.05).\n A total of 845 glucose values were available during exercise to evaluate intermittently viewed continuous glucose monitoring sensor performance. The median (interquartile range) absolute relative difference between the reference values and those obtained by the sensor across the glycaemic range overall was 22 (13.9-29.7)%, and was 36.3 (24.2-45.2)% during hypoglycaemia, 22.8 (14.6-30.6)% during euglycaemia and 15.4 (9-21)% during hyperglycaemia. Usual basal insulin dose was associated with a worse sensor performance during exercise compared with the reduced (75%) basal insulin dose [median (interquartile range) absolute relative difference: 23.7 (17.2-30.7)% vs 20.5 (12-28.1)%; P<0.001).\n The intermittently viewed continuous glucose monitoring sensor showed diminished accuracy during exercise. Absolute glucose readings derived from the sensor should be used cautiously and need confirmation by additional finger-prick blood glucose measurements.\n © 2019 Diabetes UK.\n\nAberer, Felix\n\nKöhler, Gerd\n\nKojzar, Harald\n\nMoser, Othmar\n\nSourij, Caren\n\nSourij, Harald\n\n\n"
},
{
"text": "\n178757\nLong-term effects of Na<sup>+</sup> /Ca<sup>2+</sup> exchanger inhibition with ORM-11035 improves cardiac function and remodelling without lowering blood pressure in a model of heart failure with preserved ejection fraction.\n\nPrimessnig, U\n\nBracic, T\n\nLevijoki, J\n\nOtsomaa, L\n\nPollesello, P\n\nFalcke, M\n\nPieske, B\n\nHeinzel, FR\n\nBeiträge in Fachzeitschriften\nISI:000498160200001\n31762174.0\n10.1002/ejhf.1619\nNone\nHeart failure with preserved ejection fraction (HFpEF) is increasingly common but there is currently no established pharmacological therapy. We hypothesized that ORM-11035, a novel specific Na+ /Ca2+ exchanger (NCX) inhibitor, improves cardiac function and remodelling independent of effects on arterial blood pressure in a model of cardiorenal HFpEF.\n Rats were subjected to subtotal nephrectomy (NXT) or sham operation. Eight weeks after intervention, treatment for 16 weeks with ORM-11035 (1 mg/kg body weight) or vehicle was initiated. At 24 weeks, blood pressure measurements, echocardiography and pressure-volume loops were performed. Contractile function, Ca2+ transients and NCX-mediated Ca2+ extrusion were measured in isolated ventricular cardiomyocytes. NXT rats (untreated) showed a HFpEF phenotype with left ventricular (LV) hypertrophy, LV end-diastolic pressure (LVEDP) elevation, increased brain natriuretic peptide (BNP) levels, preserved ejection fraction and pulmonary congestion. In cardiomyocytes from untreated NXT rats, early relaxation was prolonged and NCX-mediated Ca2+ extrusion was decreased. Chronic treatment with ORM-11035 significantly reduced LV hypertrophy and cardiac remodelling without lowering systolic blood pressure. LVEDP [14 ± 3 vs. 9 ± 2 mmHg; NXT (n = 12) vs. NXT + ORM (n = 12); P = 0.0002] and BNP levels [71 ± 12 vs. 49 ± 11 pg/mL; NXT (n = 12) vs. NXT + ORM (n = 12); P < 0.0001] were reduced after ORM treatment. LV cardiomyocytes from ORM-treated rats showed improved active relaxation and diastolic cytosolic Ca2+ decay as well as restored NCX-mediated Ca2+ removal, indicating NCX modulation with ORM-11035 as a promising target in the treatment of HFpEF.\n Chronic inhibition of NCX with ORM-11035 significantly attenuated cardiac remodelling and diastolic dysfunction without lowering systemic blood pressure in this model of HFpEF. Therefore, long-term treatment with selective NCX inhibitors such as ORM-11035 should be evaluated further in the treatment of heart failure.\n © 2019 The Authors. European Journal of Heart Failure published by John Wiley & Sons Ltd on behalf of European Society of Cardiology.\n\nBracic, Taja\n\n\n"
},
{
"text": "\n184307\nFalls Risk, Circadian Rhythms and Melatonin: Current Perspectives.\n\nGoswami, N\n\nAbulafia, C\n\nVigo, D\n\nMoser, M\n\nCornelissen, G\n\nCardinali, D\n\nBeiträge in Fachzeitschriften\nISI:000589939400002\n33204081.0\n10.2147/CIA.S283342\nPMC7666981\nAging is associated with weakening of the circadian system. The circadian amplitude of most physiological variables is reduced, while the circadian phase becomes more labile and tends to occur earlier with advancing age. As the incidence of falls in older persons could follow circadian variations, a better understanding of conditions in which falls occur can lead to the implementation of countermeasures (such as adjusting the scheduling of hospital staff, or changing the timing of anti-hypertensive medication if falls are related to undesirable circadian patterns of blood pressure and/or heart rate). This includes knowing the times of the day, days of the week, and times of the year when falls are more likely to occur at home or in the hospital. Additionally, the links between aging processes and factors associated with an increased risk of developing autonomic dysfunction are well established. A strong association between heart rate variability indexes and aging has been shown. Circadian rhythms of autonomous nervous system activity may play important role for maintenance of orthostatic tolerance. Whether one is concerned with disease prediction and prevention or maintenance of healthy aging, the study of circadian rhythms and the broader time structure underlying physiopathology is helpful in terms of screening, early diagnosis and prognosis, as well as the timely institution of prophylactic and/or palliative/curative treatment. Timing the administration of such treatment as a function of circadian (and other) rhythms also could lead to reduction of falls in older persons. Finally, a prominent circadian rhythm characterizes melatonin, which peaks during the night. The circadian amplitude of melatonin decreases as a function of age, raising the questions whether such a decrease in the circadian amplitude of melatonin relates to a higher risk of falls and, if so, whether melatonin supplementation may be an effective countermeasure. This narrative review assesses the relationships between fall risk and the potential role circadian rhythms and melatonin play in mitigating this risk. We aim to provide healthcare workers adequate information about fall risk in older persons, including the potential role of the circadian rhythms and/or melatonin, as well as to lay foundations for future fall prevention interventional studies.\n © 2020 Goswami et al.\n\nGoswami, Nandu\n\nMoser, Maximilian\n\n\n"
},
{
"text": "\n187732\nClinicopathologic and Genomic Characterization of Inflammatory Myofibroblastic Tumors of the Head and Neck: Highlighting a Novel Fusion and Potential Diagnostic Pitfall.\n\nKerr, DA\n\nThompson, LDR\n\nTafe, LJ\n\nJo, VY\n\nNeyaz, A\n\nDivakar, P\n\nPaydarfar, JA\n\nPastel, DA\n\nShirai, K\n\nJohn, I\n\nSeethala, RR\n\nSalgado, CM\n\nDeshpande, V\n\nBridge, JA\n\nKashofer, K\n\nBrčić, I\n\nLinos, K\n\nBeiträge in Fachzeitschriften\nNone\n34001695.0\n10.1097/PAS.0000000000001735\nNone\nInflammatory myofibroblastic tumor (IMT) is a distinctive fibroblastic and myofibroblastic spindle cell neoplasm with an accompanying inflammatory cell infiltrate and frequent receptor tyrosine kinase activation at the molecular level. The tumor may recur and rarely metastasizes. IMT is rare in the head and neck region, and limited information is available about its clinicopathologic and molecular characteristics in these subsites. Therefore, we analyzed a cohort of head and neck IMTs through a multi-institutional approach. Fourteen cases were included in the provisional cohort, but 1 was excluded after molecular analysis prompted reclassification. Patients in the final cohort included 7 males and 6 females, with a mean age of 26.5 years. Tumors were located in the larynx (n=7), oral cavity (n=3), pharynx (n=2), and mastoid (n=1). Histologically, all tumors showed neoplastic spindle cells in storiform to fascicular patterns with associated chronic inflammation, but the morphologic spectrum was wide, as is characteristic of IMT in other sites. An underlying fusion gene event was identified in 92% (n=11/12) of cases and an additional case was ALK-positive by IHC but could not be evaluated molecularly. ALK represented the driver in all but 1 case. Rearrangement of ALK, fused with the TIMP3 gene (n=6) was most commonly detected, followed by 1 case each of the following fusion gene partnerships: TPM3-ALK, KIF5B-ALK, CARS-ALK, THBS1-ALK, and a novel alteration, SLC12A2-ROS1. The excluded case was reclassified as spindle cell rhabdomyosarcoma after detection of a FUS-TFCP2 rearrangement and retrospective immunohistochemical confirmation of rhabdomyoblastic differentiation, illustrating an important diagnostic pitfall. Two IMT patients received targeted therapy with crizotinib, with a demonstrated radiographic response. One tumor recurred but none metastasized. These results add to the growing body of evidence that kinase fusions can be identified in the majority of IMTs and that molecular analysis can lead to increased diagnostic accuracy and broadened therapeutic options for patients.\n Copyright © 2021 Wolters Kluwer Health, Inc. All rights reserved.\n\nBrcic, Iva\n\nKashofer, Karl\n\n\n"
}
]
}